Вот письмо, что разослал в Сети, кому мог:
Methods for Amplification of PHANTOM DNA of 547bp with
Polymerase Chain Reaction (PCR) Using Modulated Secondary Broadband Electromagnetic Radiation (MBER) of LGN-303 Laser
as a Quantum Equivalent of Analogous Material DNA
I am writing about DNA phantoms and the “DNA Phantom Effect”, discovered by myself in 1984 using the method of correlation laser spectroscopy. The first publication about this was in 1991, [Gariaev et al, 1991, Holographic Associative Memory of Biological Systems, Proceedings SPIE - The International Society for Optical Engineering. Optical Memory and Neural Networks., v.1621, p.280- 291. USA]. Read more about the “DNA Phantom Effect” and DNA phantoms in their variety of forms in my monographs “Wave Genome”'(1994) and “Linguistics Wave Genome. Theory and Practice” (2009). You can find these monographs with Google.
In Canada (Toronto) in 2001, we used DNA phantoms in the form of secondary radiation from a LGN-303 laser (
www.plasmalabs.com/files/products/lgn_303_1.pdf) for the transmission of a pool of active genetic information over a distance of 20 km. In this experiment, pancreases of a few dozen Wistar rats were inactivated through alloxan induced diabetes. These rats were subsequently ‘injected’ with distant phantom (quantum) genetic information, read by the laser from newborn Wistar rats pancreases of the same genetic lineage. In the control group (not receiving phantom genetic information) 90% of these rats died. However, all rats that received phantom genetic information, survived. [Gariaev P.P., Kokaya A.A., Mukhina I.V., Leonova-Gariaeva E.A., Kokaya N.G. 2007. The effect of biostructures modulated electromagnetic radiation on alloxan diabetes in rats. Bulletin of Experimental Biology and Medicine, № 2, pp.155-158]. Later, these findings were confirmed by the independent group of A. Kokaya and the thesis of N. Kokaya, and the group of G.G. Tertyshniy. These works have been published.
In 2014, we obtained preliminary data on materialization of DNA phantoms, obtained in the form of spectra of secondary LGN-303 laser radiation, generated by laser reading of DNA segments of a certain length [Gariaev et al, DNA Decipher Journal / May 2014 Vol. 4 Issue 1/ pp.01-02 Materialization of DNA Fragment in Water through Modulated Electromagnetic Irradiation. Intern. Patent 2014/06578 08 Sept., 2014].
These experimental results have significant potential value. They confirm A.G. Gurvich’s (1920’s - 40’s) fundamental idea about genes functioning as wave forms. This means that now we can work in the field of new genetics and, consequently, new biology, medicine, agriculture and computing, and have a new approach to the problem of the origin of life on Earth, and so on. Nevertheless, phantom DNA data as quantum equivalents of ordinary material DNA, requires extensive reproduction by independent research groups.
That is why I am making a proposal to molecular biologists and geneticists with an invitation to take part in a large-scale open experiment for the extensive reproduction of our results. Following is a full description for the method of detection and materialization of DNA phantoms in a PCR system.
Step 1. Preparation of the Initial DNA Product
The PCR product, 547bp in length, derived from a synthetic DNA sequence, cloned in a plasmid, was used as the initial DNA product.
The plus DNA strand:
5'-CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGGGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTGGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTGGAAGCGGGCA-3'
For DNA production through PCR amplification the following primer pair was used:
5'-CCTTACGTCAGTGGAGATGTCACATC-3';
5'-TGCCCGCTTCCAAACCAATGCCTAAAGA-3'.
Each PCR mixture with a final volume of 25µL contained: 67mM Tris-HCl pH 8.6 at 25°C; 2.5mM magnesium chloride; 16.6mM ammonium sulfate; dNTPs mix at a total concentration of 300µM; primer mix in 0.5µM each; 2.5 units of Taq DNA polymerase and plasmid DNA-template in amount of 25ng. PCR temperature regime included:
- initial denaturation at 94°C - 3 min.;
- 30 cycles of: 94°C - 30 seconds, 62°C - 30 seconds, 72°C - 40 sec;
- final synthesis 72°C for 5 minutes.
The PCR product was purified from primers and other components of the PCR reaction solution using a set of reagents for purification implementing SiO2 coated magnetic particles ("Sileks",
www.sileks.com) according to the manufacturer's recommendations. 10µL of magnetic particles with binding capacity for 10 mg DNA were used. The elution of DNA was performed in 50µL of elution buffer.
Step 2. Preparation: Modulated Broadband Electromagnetic Spectrum of DNA Product.
25µL of the aqueous solution of the PCR product was applied to a clean microscope slide and used for probing by the helium-neon LGN-303 laser beam for 3 and more minutes. The resulting secondary modulated broadband electromagnetic radiation was recorded by a transistor radio at a frequency of 700 kHz and then converted into Waveform audio file format. This is the WAVE audio file we propose to use for DNA information induction (without the use of in this version the LGN-303 laser) into samples of purified water, considering that sound can carry torsion information
www.efir.com.ua/rus/a.php?r=2&d=69, including information about DNA (a hypothesis).
In addition, and at the same time the audio recording was made, DNA information induction into purified distilled water was facilitated by way of a stationary tripod with test tubes containing purified distilled water without DNA impurities, RNA and nucleases being placed at a distance of 15-20 cm from the laser. The water was pre-frozen at -20°C and thawed at room temperature (defrost water).
Step 3. PCR Amplification Using Water Samples Treated by the Modulated Broadband Electromagnetic Spectrum of the Initial DNA from which Information was Read by a LGN-303 Laser
After laser exposure, water treated by the modulated broadband electromagnetic spectrum, was used for execution of standard PCR reactions, 25µL of this water was used without addition of DNA-template material. Tripod with the tubes was placed at a distance of 20-30 cm from the laser. Preparation of the PCR reactions was performed in a sterile environment treated with UV light that would prevent contamination of samples.
Each PCR mixture contained: 67mM Tris-HCl pH 8.6 at 25°C; 2.5mM magnesium chloride; 16.6mM ammonium sulfate; dNTPs mix at a total concentration of 300µM; primer mix in 0.5µM each; 2.5 units of Taq DNA polymerase. Several temperature regimes were used for PCR, different in duration of the elongation stage (synthesis) of DNA strands at 72°C.
Initial PCR temperature regime included:
- initial denaturation at 94°C - 3 min.;
- 40 cycles: 94°C - 30 seconds, 62°C - 30 seconds, 72°C - 40 sec;
- final synthesis at 72°C for 5 minutes.
Modified PCR temperature regime included:
- initial denaturation at 94°C - 3 min.;
- 40 cycles: 94°C - 30 seconds, 62°C - 30 seconds, 72°C - 2.7min;
- final synthesis at 72°C for 5-7 minutes.
All temperature regimes resulted in synthesis of PCR products of predetermined length, but to varying degrees. The largest number of test specimens with the desired product was obtained when using a seven-minute DNA strand elongation step in each of the 40 PCR cycles.
Step 4. Analysis of PCR Results
After the completion of the PCR reaction, the samples were mixed with gel loading buffer, containing a fluorescent SYBR Green I dye ("Sileks",
www.sileks.com) and were analyzed on a 1.5% agarose gel by standard methods of gel electrophoresis in a single TBE buffer. The results were analyzed with a transilluminator at a wavelength of 365nm. Samples were considered positive where bands were located at the same distance from the start as the positive control strip, corresponding to a known DNA fragment size of 547bp
PCR positive control samples, samples of the initial DNA product from which the laser reading was made, and the experimental samples were subjected to sequencing. Sequencing revealed that the experimental samples are 99.2-100% identical to the DNA sequence of the initial product from which the information was read by the laser.
To illustrate our PCR experiments, the images of the PCR DNA phantoms are shown. A link for the download of the audio recording of DNA modulated broadband electromagnetic radiation in WAVE format on a carrier frequency of 700kGts is also provided.
A link to download the audio recording of DNA in wave format:
547bp Sound
files.mail.ru/A59F39CE29C04CD180132D8885580905
Our experiments can be reproduced without the use of a laser and without the original DNA-template (as we do too), by using the audio recording. i.e. no need to synthesize the template. This prevents accidental drifts of initial DNA into the working tubes with water, the pipettes, etc. Thus, we avoid contamination. In this case, the working sound player to be set at a distance of 1 to 20 cm from the tripod with the test tubes. The exposure time may vary from 5 minutes or more. The identity of the resulting PCR DNA product and initial DNA can be confirmed by sequencing the obtained DNA. In this type verification, all that is required is the primers and knowledge of the initial DNA nucleotide sequence…
Gariaev P.P.
Ph.D. Biology, Acad. of Russian Academy of Medical and Technical Sciences, Acad. of Academy of Natural Sciences,
Acad. of International Academy of Ecology and Life Safety,
Member of the New York Academy of Sciences, Scientific Director of Institute of Quantum Genetics
Вот в комитете лоханулись... 
